ASN's Mission

To create a world without kidney diseases, the ASN Alliance for Kidney Health elevates care by educating and informing, driving breakthroughs and innovation, and advocating for policies that create transformative changes in kidney medicine throughout the world.

learn more

Contact ASN

1401 H St, NW, Ste 900, Washington, DC 20005

email@asn-online.org

202-640-4660

The Latest on X

Kidney Week

Please note that you are viewing an archived section from 2025 and some content may be unavailable. To unlock all content for 2025, please visit the archives.

Abstract: FR-PO0286

Sodium-Glucose Cotransporter (SGLT) Protein Expression in Glomerular Cells

Session Information

Category: Diabetic Kidney Disease

  • 701 Diabetic Kidney Disease: Basic

Authors

  • Prabhakar, Sharma S., Texas Tech University Health Sciences Center School of Medicine, Lubbock, Texas, United States
  • Chatterjee, Arunita, Texas Tech University Health Sciences Center School of Medicine, Lubbock, Texas, United States
Background

Sodium glucose co-transporter (SGLT)2 blockers have been demsontrated to be renoprotective consistently by many clinical trials in the past decade. There is growing interest in exploring the mechansims of SGLT2 blockers in preserving GFR. Specifically, it is unclear if these agents have a direct effect on glomerular components. We hypothesised that apart from indirect effects through hemodynamic changes, SGLT2 blockers may impact glomerulr function by direct effect on SGLT2 proteins in the glomerular cells.

Methods

To test our hypothesis, we cultured rat mesangial cells (RMC) in DMEM medium under high glusose (25mM) labeled as HG to simulate diabetic melieu and normal glucose (5.5 mM) labeled as LG. We used cultured proximal tubular epithelial cells (TKPTS) as controls since both SGLT1 and 2 proteins are known to be expresssed in them. After confluence, the total RNA was isolated from harvested cells using an Invitrogen PureLink™ RNA Mini Kit. .qPCR was carried out using Applied Biosystems™ PowerUp™ SYBR™ Green Master Mix (Thermo Fisher Scientific). The primers used for the tested genes are as follows: (A) SGLT1: Forward - TCTGTAGTGGCAAGGGGAAG, Reverse - ACAGGGCTTCTGTGTCTTGG; (B) SGLT2: Forward - GGTGCCTGGCTGGAAAGAATCTG, Reverse - TGCCACCTCATCTGGGTAGAGAATG; and (C) β-actin: Forward - TGTCCACCTTCCAGCAGATGT, Reverse - AGCTCAGTAACAGTCCGCCTAGA. The threshold cycle (Ct) value of each sample was calculated, and the expression of the target gene mRNA relative to the internal control β-actin was determined by the 2−ΔΔCt method.

Results

As expected, TKPTS cells expressed both SGLT 1 and 2 mRNA by qPCR technique.. However of interest, inTKPTS cells, the expression of SGLT1 was much higher than SGLT2, which could be due to preponderance of cells from S3 segment origin. In RMC, there was significant expression of SGLT2 with undetectable SGLT1. In both RMC and TKPTS the expression of SGLT 1 and 2 mRNA by qPCR did not change in the presence of high glucose (HG groups).

Conclusion

This is the first evidence of SGLT2 protein expression in glomerular mesangial cells, which warrants further research into their functional significance.

SGLT 1 and 2 mRNA exression by qPCR in tubular epithelial and mesangial cells in culture

Funding

  • Private Foundation Support

Digital Object Identifier (DOI)